| Products/Services Used | Details | Operation |
|---|---|---|
| Catalog Antibody | … The chimeric promoter PQ3 was synthesized by GenScript (Hong Kong) and contains a consensus KstR operator sequence (AACTGGAACGTGTTTCAGTT) (2, 20) overlapping the -35 and -10 boxes of the lacUV5 promoter (Fig … | Get A Quote |
This study aimed to evaluate the removal of chemical oxygen demand (COD), total Kjeldahl nitrogen (TKN), total ammonia nitrogen (TAN), total phosphorus (TP), ibuprofen, acetaminophen and ethinylestradiol of synthetic effluent simulating low-strength sewage by sequencing-batch mode constructed wetlands (CWs). To verify the feasibility of using a floating macrophyte in CWs and compare different substrates, three CWs containing light expanded clay aggregates (CWL), expanded clay with porcelain tiles (CWLP) and bricks (CWB) were planted with Pistia stratiotes. The results showed that CWB achieved the highest removals of TKN (78%), TAN (70%) and TP (46%), and CWLP achieved the highest COD removal (75%). LECA favored... More
